15 Nov Genes (JIM AL-KHALILI & JOHNJOE MCFADDEN)
The ability of living organisms to faithfully transmit the instructions to make another of themselves – whether a robin, rhododendron or a person – was, for centuries, profoundly puzzling. In his ‘51st Exercitation’ of 1653, the English surgeon William Harvey wrote:
Although it be a known thing subscribed by all, that the foetus assumes its origin and birth from the male and female, and consequently that the egge is produced by the cock and henne and the chicken out of the egge, yet neither the schools of physicians nor Aristotle’s discerning brain have disclosed the manner how the cock and its seed doth mint and coine the chicken out of the egge. Part of the answer was provided two centuries later by the Austrian monk and plant scientist Gregor Mendel, who around 1850 was breeding peas in the garden of the Augustinian abbey at Brno. His observations led him to propose that traits such as flower colour or pea shape were controlled by heritable ‘factors’ that could be transmitted, unchanged, from one generation to the next. Mendel’s ‘factors’ thereby provided a repository of heritable information that allowed peas to retain their character through hundreds of generations – or through which ‘the cock and its seed doth mint and coine the chicken out of the egge’.
Mendel’s work was famously overlooked by most of his contemporaries, including Darwin, and it wasn’t until the early twentieth century that it was rediscovered. His factors were renamed genes and were soon incorporated into the growing mechanistic consensus of twentieth-century biology. But although Mendel had shown that these entities must exist inside living cells, nobody had ever seen them or knew what they were composed of. However, in 1902 the American geneticist Walter Sutton noted that intracellular structures called chromosomes tended to follow the inheritance of Mendelian factors, leading him to propose that genes were located in chromosomes.
But chromosomes are big (relatively speaking) and complicated structures composed of protein, sugars and a biochemical called deoxyribonucleic acid, or DNA. It wasn’t initially clear which, if any, of these components was responsible for heredity. Then, in 1943, the Canadian scientist Oswald Avery managed to transfer a gene from one bacterial cell to another by extracting DNA from the donor cell and injecting it into the recipient cell. The experiment demonstrated that it was the DNA in the chromosomes that carried all the vital genetic information, not the proteins or other biochemicals.fn5 Nevertheless, there seemed to be nothing magical about DNA; at this point, it was considered just an ordinary chemical.
And yet the question remained: how did this all work? How does a chemical deliver the information needed to provide ‘the manner how the cock and its seed doth mint and coine the chicken out of the egge’? And how were genes copied and replicated from one generation to the next? Conventional chemistry, driven by those Boltzmann ball-like molecules, just didn’t seem capable of providing the means to store, copy and accurately transmit genetic information.
The answer was famously provided in 1953 when James Watson and Francis Crick, working in the Cavendish Laboratory in Cambridge, managed to fit a remarkable structure to the experimental data obtained from DNA by their colleague Rosalind Franklin: the double helix. Each DNA strand was found to be a kind of molecular string made up of atoms of phosphorus, oxygen and a sugar called deoxyribose, with chemical structures called nucleotidesfn6 strung out like beads on that string. These nucleotide beads come in four varieties: adenine (A), guanine (G), cytosine (C) and thymine (T), so their arrangement along the DNA strand provides a one-dimensional sequence of genetic letters such as ‘GTCCATTGCCCGTATTACCG’. Francis Crick had spent the war years working at the Admiralty (the authority responsible for the command of the Royal Navy), so it’s conceivable he may have been familiar with codes, such as those produced by the German Enigma machines that were being decoded at Bletchley Park. In any case, when he saw the DNA strand he immediately recognized it as a code, a sequence of information that provided the crucial instructions of heredity. And, as we will discover in chapter 7, identification of the double helical DNA strand also solved the problem of how genetic information is copied. At a stroke, two of the greatest mysteries of science had been solved. The discovery of the structure of DNA provided a mechanistic key that unlocked the mystery of genes. Genes are chemicals and chemistry is just thermodynamics; so did the discovery of the double helix finally bring life entirely into the realm of classical science?
Life on the Edge: The Coming of Age of Quantum Biology
Jim Al-Khalili & Johnjoe McFadden
